ژانویه 19, 2021

دسترسي به منابع مقالات : بررسی باکتری های احیاء کننده سولفات در عفونت …

1 min read

تداخل دارویی: کلیندامایسین اثرداروهای شل کننده عضلانی غیردپولاریزان را افزایش میدهد. این دارو نسبت به اثرات داروهای نئوستیگمین وپیریدوستیگمین اثر آنتاگونیستی دارد. مصرف همزمان این دارو با اریترومایسین وکلرامفنیکل توصیه نمی شود.

۳-۴-۲ آنتی بیوتیک جنتامایسین[۴۳]

از رده آمینوگلیکوزیدهاست با جرم مولی ۵۹۶/۴۷۷ (گرم برمول) وغلظت ml10ساخت شرکت داروسازی بهسا با نیمه عمر ۲ ساعت است و اثر باکتریوسیدی دارد.
موارد مصرف: بیشتر در عفونت های میکروبهای گرم منفی مانند عفونتهای ادراری و رودهای وآبسهها به کار میرود. البته به دلیل عوارض آن امروزه کاربردش محدودتر شده است.
موارد منع مصرف: حساسیت مفرط به دارو وسایر آمینوگلیکوزیدها
عوارض جانبی: مسمویت شنوایی (اتوتوکسیسیتی)، مسمویت کلیوی (نفروتوکسیسیتی)، دهلیز شنوایی، عصبی: سردرد، دپرسیون تنفسی

۳-۴-۳ آنتی بیوتیک مترونیدازول(Metronidazol)

مترونیدازول یکی از داروهای نیتروایمیدازول با توان درمان بیماریهای عفونی ایجاد شده در اثر ارگانیسم های حساس به این دارو، بویژه باکتریهای بیهوازی و پروتوزوآهاست. غلظت این آنتی بیوتیک ۱۰ml و ساخت شرکت داروسازی بهسا.
موارد مصرف: درمان بیماریهای ایجاد شده توسط باکتری ها: واژینوز باکتریال، بیماری های التهابی لگن (همراه با سایر آنتی بیوتیکها)، کولیت پسودوممبرانو (کولیت با غشای کاذب) زخم پپتیک (برای ریشه کنی هلیکوباکترپیلوری)، بیماریهای ایجاد شده بوسیله باکتریهای بیهوازی.
درمان بیماریهای ایجاد شده توسط پروتوزوآها: واژینیت (تریکوموناس واژینالیس)، عفونتهای آمیبی، عفونتهای ژیاردیایی. بیماری کرون، بیماری روزاسه (مصرف جلدی مترونیدازول)
عوارض جانبی: تهوع و استفراغ (عوارض جانبی شایع) لکوپنی، نوتروپنی، نوروپاتی محیطی، اثرات شبه دی سولفیرام (تهوع، استفراغ، برافروختگی پوست و تاکی کاردی (هنگامی که مترونیدازول با الکل مصرف شود)، احتمال بروز نشانگان استیونس، جانسون (هنگام مصرف همزمان با مبندازول).

۳-۵- ارزیابی خواص ضدمیکروبی آنتی بیوتیک ها برباکتری های SRB مثبت

اثر ضدمیکروبی آنتی بیوتیکها برروی نمونه های مثبت SRB در مرحله قبل مورد بررسی قرارگرفت. برای این منظور به ازای هر نمونه مثبت ۶ محیط کشت API درنظر گرفته شد. شیشه اول فاقد تلقیح باکتریایی (No inoculation)، شیشه دوم یک سی سی از شیشه مثبت تلقیح گردید ولی آنتی بیوتیک به آن اضافه نشد (کنترل منفی) و در شیشههای شماره ۳ تا ۶ یک سی سی نمونه مثبت به ۱ سی سی از هر کدام از آنتی بیوتیکهای مورد بررسی به صورت جداگانه تلقیح و ۲ ماه در حرارت ۳۵ درجه گرماگذاری گردید.
 

شکل ۳-۳: تاثیر آنتی بیوتیک ها بر رشد باکتری های SRB

۳-۶- تعیین هویت مولکولی باکتری های SRB مثبت

استخراج DNA: برای این منظور، ابتدا سویه های باکتریایی به مدت ۲۴ ساعت بر روی محیط LB کشت داده شدند. سپس DNA باکتری با استفاده از کیت (Molecular Biological, Iran System Transfer) و مطابق با دستورالعمل شرکت سازنده استخراج گردید.
PCR ژن۱۶S rRNA : در این مطالعه به منظور تکثیر ناحیه ۱۶S rRNA باکتری SRB از پرایمرهای عمومی ۱۶ss 8F: (5`- AGAGTTTGATCCTGGCTCAG -3`) و ۱۶ss 1492R: (5`- GGTTACCTTGTTACGACTT – 3`)
استفاده گردید. واکنشPCR با حجم نهایی ۲۵ میکرولیتر شامل: ۱۰ نانوگرم در میکرولیتر DNA الگو، ۴/۰ میکرومولار از هر پرایمر، ۲/۰ میکرومولارdNTP ، ۲ میکرومولار MgCl2، ۵/۲ میکرولیتر بافر PCR و ۱ واحد آنزیم Taq DNA Polymerase انجام گردید. در ادامه واکنش PCR در دستگاه ترموسایکلر (Thermal Cycler PeQLab Primus 25-United Kingdom) با شرایط دمایی ۵ دقیقه واسرشت شدن ابتدایی در دمای ۹۴ درجه سانتی گراد و در ادامه ۳۵ چرخه شامل واسرشت شدن در دمای ۹۴ درجه سانتی گراد به مدت ۱ دقیقه، اتصال در دمای ۴۵ درجه سانتی گراد به مدت ۳۰ ثانیه، طویل شدن در دمای ۷۲ درجه سانتی گراد به مدت ۹۰ ثانیه و در نهایت طویل شدن نهایی در دمای ۷۲ درجه سانتی گراد به مدت ۵ دقیقه انجام شد. در نهایت محصول PCR به ژل آگاروز ۱ درصد واجد اتیدیوم برماید منتقل و به مدت ۱ ساعت در ولتاژ ۸۰ ولت الکتروفورز گردید (Sambrook and Russell 2001, 245-29).
تخلیص محصول PCR: باند bp1400 از ژل آگاروز مطابق با دستورالعمل کیت فرمنتاز (K0513) استخراج و جهت تعیین توالی برای توالییابی توسط شرکت ماهان ژن به شرکت Bioneer کره جنوبی فرستاده شد. نتایج حاصل از تعیین توالی در بانکهای ژنی بلاست شده و همولوژی آنها بررسی گردید. قرابت بالاتر از ۹۸ درصد به عنوان جنس و گونه باکتری مجهول در نظر گرفته شد (Sambrook and Russell 2001, 245-29).

۳-۷- آنالیز آماری

دادههای این پژوهش با استفاده از نسخه شانزدهم نرم افزار SPSSوMicrosofte office 2007) Excel) و آزمونهای آنالیز واریانس و مربع کای و در صورت معنا دار شدن با استفاده از ضریب همبستگی مورد آنالیز قرار گرفت. سطح معنی داری P<0.05 در نظر گرفته شد.

فصل چهارم:

نتایج یافته های تحقیق

۴-۱- مقدمه

در ابتدا، نتایج حاصل از تحلیل داده‌ها ارائه می‌گردد. در تجزیه و تحلیل داده‌ها، ابتدا با استفاده از جدول‌های فراوانی و نمودارهای میله‌ای (ستونی) توصیفی از برخی ویژگی‌های جمعیت شناختی ارائه می‌گردد. سپس تجزیه و تحلیل نتایج با استفاده از جدول توافق (مجذور کای) انجام شده و در صورت معنا دار شدن ضریب همبستگی نیز محاسبه گردیده و به همراه جداول و نمودارها ارائه گردیده است.

۴-۲- تجزیه و تحلیل نتایج جمعیت شناختی

یافته های حاصل از ویژگیهای دموگرافیک (جمعیتی) پرسشنامه در جداول و نمودارهای مربوطه ارائه شده است.

۴-۲-۱ جنسیت

از بین ۵۰ نفر از افرادی که مورد بررسی قرار گرفتند، ۲۸ نفر (۵۶% ) مونث، ۲۲نفر (۴۴%) مذکر میباشند و مقدار معناداری برابر با ۳۹۶/۰ میباشد که در سطح ۰۵/۰ نشان دهنده معنادار نشدن متغییر جنسیت میباشد (جدول و نمودار ۴-۱).

جدول ۴-۱: توزیع فراوانی و افراد بر حسب جنسیت

جنسیت فراوانی درصد فراوانی
مونث ۲۸ ۵۶
مذکر ۲۲
برای دانلود متن کامل پایان نامه به سایت zusa.ir مراجعه نمایید.
Copyright © All rights reserved. | Newsphere by AF themes.